Many entity types can be uploaded in bulk using any common tabular format. Protein and nucleotide sequences can be imported using the GenBank format.

Upon upload, the registry will calculate and create any molecular species and sets as appropriate.

You can bulk upload the following entity types:
  • Cell Lines
  • Molecules
  • Nucleotide Sequences
  • Protein Sequences
  • Vectors
  • Constructs
  • Expression Systems
And the following other types:
  • Mixtures
  • Mixture Batches

Supported File Formats

Tabular file formats are supported for all entity types:

  • Excel: .xls, .xlsx
  • Text: .csv, .tsv
Nucleotide sequences, protein sequences and constructs can also be imported using GenBank file formats:
  • GenBank: .genbank, .gb, .gbk
LabKey Biologics parses GenBank files for sequences and associated annotation features. When importing GenBank files, corresponding entities, such as new nucleotide and protein sequences, are added to the registry.

Assemble Bulk Entity Data

When assembling your entity data into a tabular format, keep in mind that each entity type has a different set of required column headings.

To acquire a template Excel file for a given entity, do the following:

  • In the registry, go the entity type you with to upload.
  • Select Manage > Import Data.
  • Click the Template button to download the template Excel file.
  • Open the Excel file, and add data as appropriate under the column headers. See examples below.

Bulk Upload Entity Data

After you have assembled your entity information into a table, you can upload it to the registry:

  • Go the entity type you wish to import.
  • Select Manage > Import Data.
  • On the Import page, either Upload Files or Copy-and-Paste Data using the tabs.
    • If you stay on the Upload Files tab, drag and drop your file into the target area and click Finish.
    • If you select the Copy-and-paste Data tab, select TSV or CSV as appropriate, copy and paste your data (including the header row) into the text box, and click Finish.

Bulk Data Example Files

Example Nucleotide Sequence File


  • Annotations: Add annotation data using a JSON snippet, format is shown below.
NS-23Signal Peptide 1An important sequence.FALSE[{name: "PS-23"}]CCCCTCCTTG
name:"First Annotation",
name:"Another Annotation",

When importing the rows for NucSequence, you can reference the corresponding ProtSequence and the translation start, end, and offset. (The offsets are 1-based.) An example:

NS-100Signal Peptide 1some descriptionFALSE[{name: "PS-100", nucleotideStart=1, nucleotideEnd=30, translationFrame=2}]ATGGAGTTGGGACTGAGCTGGATTTTCCTTTTGGCTATTTTAAAAGGTGTCCAGTGT 

Example Protein Sequence File


  • Organisms: A comma separated list of applicable organisms. The list, even if it has only one member, must be framed by square brackets. Examples: [human] OR [human, rat, mouse]
  • ?: The column header for the extinction coefficient (ε).
  • %?: The column header for the % extinction coefficient ().
NameAliasDescriptionNuc SequencesChain FormatAvg. MasspI?%?Num. S-SNum. CysOrganismsSequence
PStest-150 Test sequence for import 113999.648.030355002.5412[mouse, rat]EVQLVESGEL

Mixtures and Batches

The text 'unknown' can entered for certain fields. For Mixtures, the Amount field; for Mixture Batches, the Amount and the RawMaterial fields.

Mixture Bulk Upload

TypeIngredient/MixtureAmount Unit Type

Batch Bulk Upload

IngredientAmount UsedRaw Material Used
Sodium phosphate dibasic anhydrous5RawMat-1234
Sodium Chlorideunknownunknown
Potassium chlorideunknownunknown

Downloadable Example Files

Download a sample file for a given entity type:

Related Topics


Was this content helpful?

Log in or register an account to provide feedback

expand all collapse all