Biologics Tutorial: Add Sequences to the Registry

2024-04-19

This tutorial provides step-by-step instructions for adding an antibody, Aducanumab, to the Biologics registry.

Along the way it illustrates:

Adding nucleotide sequences to the registry
Options for translating protein sequences from the above
Entity relationships
The protein classification system which detects and annotates protein formats and components
Calculated values for new sequences

This topic describes the manual process for adding a single entry to the registry. There are other options for adding entities, including bulk import options, importing GenBank files, and API-based insert methods.

Note that when you create your own entities, the registry names are auto-generated, and therefore may differ from the names shown in these tutorials.

Set Up Trial Server

This tutorial assumes that you have registered and created a Biologics Trial instance of the server.
If you have already created a biologics trial server, select it, and login: Your Sites

Register a Nucleotide Sequence

We register a sequence composed of a leader sequence + the light chain for Aducanumab.

On the Biologics home page, click the Registry button.

On the Registry page, click Nucleotide Sequences button.

On the Nucleotide Sequences page, click Create and select Nucleotide Sequence.

On the page Register a New Nucleotide Sequence, fill out the form as follows:
Description:

Signal Peptide 4 + Aducanumab Light Chain. The Light chain sequence of a IgG1 monoclonal antibody, which targets aggregated forms of β-amyloid (Aβ) in the hopes of reducing its buildup. Leader sequence HV103_HUMAN has been added.

Alias: Add the two values below. Hit the Tab key to confirm each entry:

Aducanumab Light Chain

HV103_HUMAN

Nucleotide Sequence Parents: Leave Blank
Sequence: Copy and paste this sequence:

ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCAACAGGTGC
CCACTCGGATATTCAGATGACCCAGAGCCCGAGCAGCCTGAGCGCGAGCG
TGGGCGATCGCGTGACCATTACCTGCCGCGCGAGCCAGAGCATTAGCAGC
TATCTGAACTGGTATCAGCAGAAACCGGGCAAAGCGCCGAAACTGCTGAT
TTATGCGGCGAGCAGCCTGCAGAGCGGCGTGCCGAGCCGCTTTAGCGGCA
GCGGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGCCGGAA
GATTTTGCGACCTATTATTGCCAGCAGAGCTATAGCACCCCGCTGACCTT
TGGCGGCGGCACCAAAGTGGAAATTAAACGCACCGTGGCGGCGCCGAGCG
TGTTTATTTTTCCGCCGAGCGATGAACAGCTGAAAAGCGGCACCGCGAGC
GTGGTGTGCCTGCTGAACAACTTTTATCCGCGCGAAGCGAAAGTGCAGTG
GAAAGTGGATAACGCGCTGCAGAGCGGCAACAGCCAGGAAAGCGTGACCG
AACAGGATAGCAAAGATAGCACCTATAGCCTGAGCAGCACCCTGACCCTG
AGCAAAGCGGATTATGAAAAACATAAAGTGTATGCGTGCGAAGTGACCCA
TCAGGGCCTGAGCAGCCCGGTGACCAAAAGCTTTAACCGCGGCGAATGC

Annotations: Leave Blank
On the bottom right of the page, click Next.

On the Confirm tab, review your entries and click Finish.
The registry nucleotide sequence will be added to the registry. The name of the sequence (in these screenshots "NS-13") may be different in your registry, as the name is generated automatically. Once a new sequence is added, the registry enforces its uniqueness: if you attempt to register the same sequence twice, you will receive an error message.

Translate and Register a Protein Sequence

To translate a protein sequence based on this nucleotide sequence, follow the instructions below.

On the Nucleotide Sequences page, click NS-13, or whatever the system has named your new nucleotide sequence.

On the nucleotide sequence details page, select Create > Protein Sequences. (Note there are similar workflows available for Constructs and Vectors.)

On the page Register a New Protein Sequence, enter the following information in the form:
Description: Leave the automatically entered text unchanged.
Alias:

Aducanumab Light Chain

Organisms:

Human

Protein Sequence Parents: Leave blank. (Use this when parent protein sequences are already in the registry.)
Seq Part: Leave blank. (Use this when you know the sequence type, like Leader, Linker, or Tag.)
Click Next.

On the Sequence tab, click the dropdown Translation Frame and select "1". (Note that selecting "2" or "3" will re-render the sequence preview panes, as will manually refining the Protein Start and End points.)
Click Next.

The system searches the protein classification library and generates annotations for the sequence parts.
Click Next on all remaining screens of the wizard. The wizard shows you calculated information on the following tabs:
On the Annotations tab, review the information, and click Next.
On the Properties tab, the system calculates a number of physical properties of the protein sequence. Review the information, and click Next.
On the Confirm tab, click Finish.
The new protein will be added to the registry. The auto-generated name of the new protein (in this case PS-27) may be different in your registry.

Click the name of the new protein to see the details page. Under Related Entities, notice the link to the originating nucleotide sequence (NS-13).