Biologics Tutorial: Add Sequences to the Registry

Documentation
This tutorial provides step-by-step instructions for adding an antibody, Aducanumab, to the Biologics registry.

Along the way it illustrates:

  • Adding nucleotide sequences to the registry
  • Options for translating protein sequences from the above
  • Entity relationships
  • The protein classification system which detects and annotates protein formats and components
  • Calculated values for new sequences
This topic describes the manual process for adding a single entry to the registry. There are other options for adding entities, including bulk import options, importing GenBank files, and API-based insert methods.

Note that when you create your own entities, the registry names are auto-generated, and therefore may differ from the names shown in these tutorials.

Set Up Trial Server

  • This tutorial assumes that you have registered and created a Biologics Trial instance of the server.
  • If you have already created a biologics trial server, select it, and login: Your Sites

Register a Nucleotide Sequence

We register a sequence composed of a leader sequence + the light chain for Aducanumab.

  • On the Biologics home page, click the Registry button.
  • On the Registry page, click Nucleotide Sequence button.
  • On the Nucleotide Sequences page, click Create and select Nucleotide Sequence.
  • On the page Register a New Nucleotide Sequence, fill out the form as follows:
  • Description:
Signal Peptide 4 + Aducanumab Light Chain. The Light chain sequence of a IgG1 monoclonal antibody, which targets aggregated forms of β-amyloid (Aβ) in the hopes of reducing its buildup. Leader sequence HV103_HUMAN has been added.
  • Alias: Add the two values below. Hit the Tab key to confirm each entry:
Aducanumab Light Chain

HV103_HUMAN
  • Nucleotide Sequence Parents: Leave Blank
  • Sequence: Copy and paste this sequence:
ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCAACAGGTGC
CCACTCGGATATTCAGATGACCCAGAGCCCGAGCAGCCTGAGCGCGAGCG
TGGGCGATCGCGTGACCATTACCTGCCGCGCGAGCCAGAGCATTAGCAGC
TATCTGAACTGGTATCAGCAGAAACCGGGCAAAGCGCCGAAACTGCTGAT
TTATGCGGCGAGCAGCCTGCAGAGCGGCGTGCCGAGCCGCTTTAGCGGCA
GCGGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGCCGGAA
GATTTTGCGACCTATTATTGCCAGCAGAGCTATAGCACCCCGCTGACCTT
TGGCGGCGGCACCAAAGTGGAAATTAAACGCACCGTGGCGGCGCCGAGCG
TGTTTATTTTTCCGCCGAGCGATGAACAGCTGAAAAGCGGCACCGCGAGC
GTGGTGTGCCTGCTGAACAACTTTTATCCGCGCGAAGCGAAAGTGCAGTG
GAAAGTGGATAACGCGCTGCAGAGCGGCAACAGCCAGGAAAGCGTGACCG
AACAGGATAGCAAAGATAGCACCTATAGCCTGAGCAGCACCCTGACCCTG
AGCAAAGCGGATTATGAAAAACATAAAGTGTATGCGTGCGAAGTGACCCA
TCAGGGCCTGAGCAGCCCGGTGACCAAAAGCTTTAACCGCGGCGAATGC
  • Annotations: Leave Blank
  • On the bottom right of the page, click Next.
  • On the Confirm tab, review your entries and click Finish.
  • The registry nucleotide sequence will be added to the registry. The name of the sequence (in these screenshots "NS-13") may be different in your registry, as the name is generated automatically. Once a new sequence is added, the registry enforces its uniqueness: if you attempt to register the same sequence twice, you will receive an error message.

Translate and Register a Protein Sequence

To translate a protein sequence based on this nucleotide sequence, follow the instructions below.

  • On the Nucleotide Sequences page, click NS-13, or whatever the system has named your new nucleotide sequence.
  • On the nucleotide sequence details page, select Create > Protein Sequences. (Note there are similar workflows available for Constructs and Vectors.)
  • On the page Register a New Protein Sequence, enter the following information in the form:
  • Description: Leave the automatically entered text unchanged.
  • Alias:
Aducanumab Light Chain
  • Organisms:
Human
  • Protein Sequence Parents: Leave blank. (Use this when parent protein sequences are already in the registry.)
  • Seq Part: Leave blank. (Use this when you know the sequence type, like "Leader" or "Linker".)
  • Click Next.
  • On the Sequence tab, click the dropdown Translation Frame and select "1". (Note that selecting "2" or "3" will re-render the sequence preview panes, as will manually refining the Protein Start and End points.)
  • Click Next.
  • The system searches the protein classification library and generates annotations for the sequence parts.
  • Click Next on all remaining screens of the wizard. The wizard shows you calcluated information on the following tabs:
  • On the Annotations tab, review the information, and click Next.
  • On the Properties tab, the system calculates a number of physical properties of the protein sequence. Review the information, and click Next.
  • On the Confirm tab, click Finish.
  • The new protein will be added to the registry. The auto-generated name of the new protein (in this case PS-27) may be different in your registry.
  • Click the name of the new protein to see the details page. Under Related Entities, notice the link to the originating nucleotide sequence (NS-13).

Tutorial Curriculum

Biologics Tutorial: Navigate and Search the Registry

Biologics Tutorial: Register Samples and Experiments

Discussion

Was this content helpful?

Log in or register an account to provide feedback


previousnext
 
expand all collapse all